o Rŀgwk@sdZddlZddlmZddlmZddlmZzddlZWne y0ddl m Z e ddwddl m Z dd l mZdd lmZdd d ZdddZdddZGdddeZGdddZddZedkrvddlmZedddSdS)a>Tools for sequence motif analysis. Bio.motifs contains the core Motif class containing various I/O methods as well as methods for motif comparisons and motif searching in sequences. It also includes functionality for parsing output from the AlignACE, MEME, and MAST programs, as well as files in the TRANSFAC format. N) urlencode)Request)urlopen)MissingPythonDependencyErrorz,Install NumPy if you want to use Bio.motifs.)BiopythonDeprecationWarning) Alignment)reverse_complementACGTcCst|}t||dS)zCreate a Motif object.) alignmentalphabet)rMotif) instancesr r rG/var/www/html/myenv/lib/python3.10/site-packages/Bio/motifs/__init__.pycreate%s rTc Cs(|}|dkrddlm}||S|dkr"ddlm}||S|dkr1ddlm}||S|dkr@dd lm}||S|d vrPdd lm}|||S|d kr_dd lm}||S|dkrnddlm } | |S|dkr~ddlm } | ||S|dvrddlm } | ||St d|)aParse an output file from a motif finding program. Currently supported formats (case is ignored): - AlignAce: AlignAce output file format - ClusterBuster: Cluster Buster position frequency matrix format - XMS: XMS matrix format - MEME: MEME output file motif - MINIMAL: MINIMAL MEME output file motif - MAST: MAST output file motif - TRANSFAC: TRANSFAC database file format - pfm-four-columns: Generic position-frequency matrix format with four columns. (cisbp, homer, hocomoco, neph, tiffin) - pfm-four-rows: Generic position-frequency matrix format with four row. (scertf, yetfasco, hdpi, idmmpmm, flyfactor survey) - pfm: JASPAR-style position-frequency matrix - jaspar: JASPAR-style multiple PFM format - sites: JASPAR-style sites file As files in the pfm and sites formats contain only a single motif, it is easier to use Bio.motifs.read() instead of Bio.motifs.parse() for those. For example: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... for m in motifs.parse(handle, "AlignAce"): ... print(m.consensus) ... TCTACGATTGAG CTGCACCTAGCTACGAGTGAG GTGCCCTAAGCATACTAGGCG GCCACTAGCAGAGCAGGGGGC CGACTCAGAGGTT CCACGCTAAGAGAAGTGCCGGAG GCACGTCCCTGAGCA GTCCATCGCAAAGCGTGGGGC GAGATCAGAGGGCCG TGGACGCGGGG GACCAGAGCCTCGCATGGGGG AGCGCGCGTG GCCGGTTGCTGTTCATTAGG ACCGACGGCAGCTAAAAGGG GACGCCGGGGAT CGACTCGCGCTTACAAGG If strict is True (default), the parser will raise a ValueError if the file contents does not strictly comply with the specified file format. alignacer)rmeme)rminimal)r clusterbusterr)zpfm-four-columnsz pfm-four-rows)pfmxms)rmast)rtransfacr)rsitesjasparrzUnknown format %s) lower Bio.motifsrreadrrrrrrrr ValueError) handlefmtstrictrrrrrrrrrrrrparse+s:0                   r%cCsH|}t|||}t|dkrtdt|dkrtd|d}|S)a;Read a motif from a handle using the specified file-format. This supports the same formats as Bio.motifs.parse(), but only for files containing exactly one motif. For example, reading a JASPAR-style pfm file: >>> from Bio import motifs >>> with open("motifs/SRF.pfm") as handle: ... m = motifs.read(handle, "pfm") >>> m.consensus Seq('GCCCATATATGG') Or a single-motif MEME file, >>> from Bio import motifs >>> with open("motifs/meme.psp_test.classic.zoops.xml") as handle: ... m = motifs.read(handle, "meme") >>> m.consensus Seq('GCTTATGTAA') If the handle contains no records, or more than one record, an exception is raised: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... motif = motifs.read(handle, "AlignAce") Traceback (most recent call last): ... ValueError: More than one motif found in handle If however you want the first motif from a file containing multiple motifs this function would raise an exception (as shown in the example above). Instead use: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... record = motifs.parse(handle, "alignace") >>> motif = record[0] >>> motif.consensus Seq('TCTACGATTGAG') Use the Bio.motifs.parse(handle, fmt) function if you want to read multiple records from the handle. If strict is True (default), the parser will raise a ValueError if the file contents does not strictly comply with the specified file format. rzNo motifs found in handlez#More than one motif found in handle)rr%lenr!)r"r#r$motifsmotifrrrr s0   r c@s:eZdZdZdddZddZdd Zd d Zd d ZdS) Instancesz:Class containing a list of sequences that made the motifs.Nr c Csddlm}ddlm}tdtt|||tfrtdd}|dur[g}|D]-}|dur3t |}n|t |krEdt ||f}t |t||sP|t|}| |q(| |||_ ||_dS)Initialize the class.r MutableSeqSeqaThe Instances class has been deprecated; please use the Alignment class in Bio.Align instead. To create a Motif instance, instead of >>> from Bio.motifs import Instances >>> instances = Instances([Seq('ACGT'), Seq('ACCT'), Seq('AAGT')]) >>> motif = Motif(alphabet='ACGT', instances=instances) please use >>> from Bio.Align import Alignment >>> alignment = Alignment([Seq('ACGT'), Seq('ACCT'), Seq('AAGT')]) >>> motif = Motif(alphabet='ACGT', alignment=alignment) zinstances should be iterator of Seq objects or strings. If a single sequence is given, will treat each character as a separate sequence.NzAAll instances should have the same length (%d found, %d expected))Bio.Seqr-r/warningswarnr isinstancestr TypeErrorr'r!appendextendlengthr ) selfr r r-r/r8 sequencesinstancemessagerrr__init__s8           zInstances.__init__cCs"d}|D] }|t|d7}q|S)z6Return a string containing the sequences of the motif. r4)r9textr;rrr__str__szInstances.__str__cCsTi}|jD] }dg|j||<q|D]}t|D]\}}|||d7<qq|S)z Count nucleotides in a position.rr&)r r8 enumerate)r9countsletterr;positionrrrcounts zInstances.countccs\tdttt||jdD]}|D]}|||||jkr*||fVnqqdS)zFind positions of motifs in a given sequence. This is a generator function, returning found positions of motif instances in a given sequence. z~instances.search(sequence) has been deprecated. Please use sequence.search(instances) instead, where sequence is a Seq object.r&N)r1r2rranger'r8)r9sequenceposr;rrrsearchs zInstances.searchcCsddlm}ddlm}ddlm}t|jd}|j|_|D]&}t||||fr-| }nt|t r7t |}nt dt || |q|S)z(Compute reverse complement of sequences.rr,r.) SeqRecord)r zinstance has unexpected type %s)r0r-r/ Bio.SeqRecordrLr*r r8r3rr4 RuntimeErrortyper6)r9r-r/rLr r;rrrrs        zInstances.reverse_complement)Nr ) __name__ __module__ __qualname____doc__r=rBrGrKrrrrrr*s 0 r*c@seZdZdZd0ddZddZdd ZeeeZ[[d d Z d d Z ee e Z [ [ ddZ ddZ ee e Z[ [ ddZeddZeddZeddZd1ddZddZdd Zed!d"Zed#d$Zed%d&Zed'd(Zd2d*d+Zd,d-Zd.d/ZdS)3r z%A class representing sequence motifs.r Nc Cs4ddlm}d|_|dur|durttdt|tr|}d}|dur9tdt |dur2ttdt |}|j }|durF|durFttd|durZd|_ | |||_|jj|_n2|dur|j}|j}|D]}||vrtt|t||<qf| |||_||_ ||_n d|_d|_ d|_||_ d|_d|_d|_dS) r+r&)matrixr>Nz9Specify either alignment or instances, don't specify bothaSThe instances argument has been deprecated. Instead of >>> instances = [Seq('ACGT'), Seq('ACCT'), Seq('AAGT')] >>> motif = Motif(alphabet='ACGT', instances=instances) please use >>> from Bio.Align import Alignment >>> alignment = Alignment([Seq('ACGT'), Seq('ACCT'), Seq('AAGT')]) >>> motif = Motif(alphabet='ACGT', alignment=alignment) z6Specify either counts or instances, don't specify bothz9Specify either counts or an alignment, don't specify both)r>rTname Exceptionr!r3r*r1r2rrr r FrequencyPositionMatrixrDr8 frequenciesnpzerosint pseudocounts backgroundmask) r9r r rDr rTr8rXrErrrr=(sZ     zMotif.__init__cC|jSN) _Motif__maskr9rrr __get_maskczMotif.__get_maskcCs|jdur d|_dS|durd|j|_dSt||jkr(tdt||jft|trXg|_|D]}|dkr?|jdq2|dkrJ|jdq2td|t|j|_dStd d |D|_dS) Nr)r&zMThe length (%d) of the mask is inconsistent with the length (%d) of the motif*r& rz2Mask should contain only '*' or ' ' and not a '%s'css|] }tt|VqdSr`)r[bool.0crrr }sz#Motif.__set_mask..)r8rar'r!r3r4r6tuple)r9r^charrrr __set_maskfs,    zMotif.__set_maskcCr_r`) _pseudocountsrbrrr__get_pseudocountsrdzMotif.__get_pseudocountscsJi|_ttrfdd|jD|_dSdurdt|j|_dS)Nci|]}||qSrrrirEvaluerr z,Motif.__set_pseudocounts..g)ror3dictr fromkeys)r9rtrrsr__set_pseudocountss  zMotif.__set_pseudocountscCr_r`) _backgroundrbrrr__get_backgroundrdzMotif.__get_backgroundcsttrfdd|jD|_n:durt|jd|_n-t|jgdkr+tddd|jd<d|jd<d|jd <dd|jd <t|j}|jD] }|j||<qUdS) Ncrqrrrrrsrrrurvz*Motif.__set_background..g?ACGTz}Setting the background to a single value only works for DNA motifs (in which case the value is interpreted as the GC content)g@r}r~rr) r3rwr rzrxsortedr!sumvalues)r9rttotalrErrsr__set_backgrounds  zMotif.__set_backgroundcstts tdj}jdur&d}jdurd}nfdd|D}n jddf}d}t|||d}j|_|dur_|dur_zj}Wn t yTYn wt t ||_j |_ j|_|S)aBReturn a new Motif object for the positions included in key. >>> from Bio import motifs >>> motif = motifs.create(["AACGCCA", "ACCGCCC", "AACTCCG"]) >>> print(motif) AACGCCA ACCGCCC AACTCCG >>> print(motif[:-1]) AACGCC ACCGCC AACTCC zmotif indices must be slicesNcsi|] }|j|qSr)rDrrkeyr9rrrusz%Motif.__getitem__..)r r rD)r3slicer5r r rDr r^r8AttributeErrorr'rHindicesr\copyr])r9rr r rDr)r8rrr __getitem__s,        zMotif.__getitem__cC|j|jS)z?Calculate and return the position weight matrix for this motif.)rD normalizerorbrrrpwmz Motif.pwmcCr)zICalculate and return the position specific scoring matrix for this motif.)rlog_oddsrzrbrrrpssmrz Motif.pssmcCs"tdt|jdur dS|jjS)z4Return the sequences from which the motif was built.zrThe instances attribute has been deprecated. Instead of mymotif.instances, please use mymotif.alignment.sequences.N)r1r2rr r:rbrrrr s zMotif.instancesFcCsZd}|jdur|d|j7}|r+t|jD]}|j|r"|d7}q|d7}q|d7}|S)z(Return string representation of a motif.r>Nr?rerf)r joinrHr8ra)r9maskedrAirrrrBs    z Motif.__str__cCs|jdurdS|jS)zReturn the length of a motif. Please use this method (i.e. invoke len(m)) instead of referring to m.length directly. Nr)r8rbrrr__len__s z Motif.__len__cCs|j}|jdur|j}t||d}n-|jdddd|jdddd|jdddd|jddddd}t||d }|jddd|_|jd|jd|jd|jdd|_|jd|jd|jd|jdd|_|S) z:Return the reverse complement of the motif as a new motif.N)r r rrr~r}r|)r rD)r r rr rDrar]r\)r9r r resrDrrrrs,   zMotif.reverse_complementcC|jjS)zReturn the consensus sequence.)rD consensusrbrrrrzMotif.consensuscCr)zBReturn the least probable pattern to be generated from this motif.)rD anticonsensusrbrrrr$rzMotif.anticonsensuscCr)aKReturn the degenerate consensus sequence. Following the rules adapted from D. R. Cavener: "Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates." Nucleic Acids Research 15(4): 1353-1361. (1987). The same rules are used by TRANSFAC. )rDdegenerate_consensusrbrrrr)s zMotif.degenerate_consensusc sH|j}|j|j|j|j}t|}|jdurZtfddt |D} D]*\}}t||}|dk}||||}|||t |||7<q-|St|} D]\}}|t||7}qc D]*\}}t||}|dk}||||}|||t |||7<qw|S)zGReturn an array with the relative entropy for each column of the motif.Ncs&g|]tfddDqS)c3s$|] }||VqdSr`rrh)rDrr\rrrkBs"z4Motif.relative_entropy...)r)rir rDr\)rr Asz*Motif.relative_entropy..r) r]r\r rDr8rYrZr arrayrHitemslog2)r9r]r8rrrErXr^rrrrelative_entropy6s6  $ $zMotif.relative_entropyPNGcKs|dur tdtt|jtdkrd}nt|jtdkr"d}nt|jtdkr.d}nd }t|d }d }id |d |ddddd|dddddddddt|jddddddd dd!dd"dd#did$dd%dd&dd'd d(d)d*dd+dd,d-d.dd/dd0dd1dd2dd3dd4dd5dd6dd7di}| d8d9| Dt | d:} t || } t| } t|d;} | } | | WddS1swYdS) scale_widthshow_errorbars logo_title logo_label show_xaxis xaxis_label show_yaxis yaxis_label yaxis_scaleyaxis_tic_intervalz1.0 show_endsshow_fineprint color_scheme color_autosymbols0symbols1symbols2symbols3symbols4color0color1color2color3color4cSs&i|]\}}||dur dnt|qS)Fr>r@)rikvrrrrus&z!Motif.weblogo..zutf-8wb)r1r2rsetr rrr4r8updaterrencoderropenr write)r9fnamer#versionkwdsalpharXurlrdatareqresponsefimrrrweblogoVs1       !"#&   "z Motif.weblogocCs|dvrddlm}|g}|||S|dkr%ddlm}|g}||S|dkr7ddlm}|g}||S|s=t|Std|) [Return a string representation of the Motif in the given format. Currently supported formats: - clusterbuster: Cluster Buster position frequency matrix format - pfm : JASPAR single Position Frequency Matrix - jaspar : JASPAR multiple Position Frequency Matrix - transfac : TRANSFAC like files rrrrrrrrUnknown format type %s)rrrrrr4r!)r9 format_specrr(rrrrr __format__s       zMotif.__format__cCs ||S)r)r)r9rrrrrs z Motif.format)r NNN)F)rN)rPrQrRrSr=_Motif__get_mask_Motif__set_maskpropertyr^_Motif__get_pseudocounts_Motif__set_pseudocountsr\_Motif__get_background_Motif__set_backgroundr]rrrr rBrrrrrrrrrrrrrr %sN ;   '          p r cCsp|}|dvrddlm}|||S|dkr#ddlm}||S|dkr2ddlm}||Std|) aJReturn a string representation of motifs in the given format. Currently supported formats (case is ignored): - clusterbuster: Cluster Buster position frequency matrix format - pfm : JASPAR simple single Position Frequency Matrix - jaspar : JASPAR multiple PFM format - transfac : TRANSFAC like files rrrrrrrr)rrrrrrr!)r(r#rrrrrrrs        r__main__) run_doctest)verbose)r )T)rSr1 urllib.parserurllib.requestrrnumpyrY ImportErrorBiorr Bio.Alignrr0rrr%r listr*r rrP Bio._utilsrrrrrs>             Y:gP